Product Details

SNP ID: rs142881710
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:161228462 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGTAGCTACATTGAATGTGGGATC[A/G]GGCGGGGCCCATGCAAGTTACTACC
Phenotype: MIM: 107670 MIM: 147139 MIM: 603881
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APOA2 PubMed Links

Gene Details

Gene: APOA2
Gene Name: apolipoprotein A2

There are no transcripts associated with this gene.

Gene: FCER1G
Gene Name: Fc fragment of IgE receptor Ig

There are no transcripts associated with this gene.

Gene: MIR5187
Gene Name: microRNA 5187

There are no transcripts associated with this gene.

Gene: NR1I3
Gene Name: nuclear receptor subfamily 1 group I member 3

There are no transcripts associated with this gene.

Gene: TOMM40L
Gene Name: translocase of outer mitochondrial membrane 40 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286373.1	975	Silent Mutation	TCA,TCG	S180S	NP_001273302.1
NM_001286374.1	975	Silent Mutation	TCA,TCG	S149S	NP_001273303.1
NM_032174.5	975	Silent Mutation	TCA,TCG	S214S	NP_115550.2
XM_006711572.2	975	Silent Mutation	TCA,TCG	S214S	XP_006711635.1
XM_011510057.2	975	Silent Mutation	TCA,TCG	S149S	XP_011508359.1
XM_017002481.1	975	Silent Mutation	TCA,TCG	S214S	XP_016857970.1
XM_017002482.1	975	Silent Mutation	TCA,TCG	S180S	XP_016857971.1

View Full Product Details