Product Details

SNP ID: rs144417847
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:151176917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCGCCCTTGGGGGAACCATTCCTC[A/G]AAAGTTGCATCATCACTAAAAGTGA
Phenotype: MIM: 608095 MIM: 605834 MIM: 600607
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: SCNM1 PubMed Links

Gene Details

Gene: SCNM1
Gene Name: sodium channel modifier 1

There are no transcripts associated with this gene.

Gene: TMOD4
Gene Name: tropomodulin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013353.2	914	Intron			NP_037485.2
XM_011509449.1	914	Intron			XP_011507751.1
XM_017001089.1	914	Intron			XP_016856578.1
XM_017001090.1	914	Intron			XP_016856579.1

Gene: TNFAIP8L2-SCNM1
Gene Name: TNFAIP8L2-SCNM1 readthrough

There are no transcripts associated with this gene.

Gene: VPS72
Gene Name: vacuolar protein sorting 72 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271087.1	914	Silent Mutation	TTC,TTT	F285F	NP_001258016.1
NM_001271088.1	914	Intron			NP_001258017.1
NM_005997.2	914	Silent Mutation	TTC,TTT	F274F	NP_005988.1
XM_017002205.1	914	Silent Mutation	TTC,TTT	F153F	XP_016857694.1

View Full Product Details