Product Details

SNP ID: rs150618710
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:16015661 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCGTGCCCGGATAGTGAGGCTGCC[A/G]TCCTCCCGCAGAGCCGAGGTCACCG
Phenotype: MIM: 602024 MIM: 610692
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C1orf64 PubMed Links

Gene Details

Gene: C1orf64
Gene Name: chromosome 1 open reading frame 64

There are no transcripts associated with this gene.

Gene: CLCNKA
Gene Name: chloride voltage-gated channel Ka

There are no transcripts associated with this gene.

Gene: HSPB7
Gene Name: heat shock protein family B (small) member 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014424.4	1259	Silent Mutation	GAC,GAT	D144D	NP_055239.1
XM_011541249.1	1259	Silent Mutation	GAC,GAT	D237D	XP_011539551.1
XM_011541250.2	1259	Silent Mutation	GAC,GAT	D236D	XP_011539552.1

View Full Product Details