Product Details

SNP ID: rs140247642
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45365635 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCTCAGATCCTGGGCTTTTCCA[C/G]CCCTCCAGGCCGGCTCTCCATGATG
Phenotype: MIM: 612979
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: SYS1 PubMed Links

Gene Details

Gene: SYS1
Gene Name: Sys1 golgi trafficking protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099791.2	398	Missense Mutation	ACC,AGC	T60S	NP_001093261.1
NM_001197129.1	398	Missense Mutation	ACC,AGC	T60S	NP_001184058.1
NM_033542.3	398	Missense Mutation	ACC,AGC	T60S	NP_291020.1

Gene: SYS1-DBNDD2
Gene Name: SYS1-DBNDD2 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TP53TG5
Gene Name: TP53 target 5

There are no transcripts associated with this gene.

View Full Product Details