Product Details

SNP ID

rs144051050

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.20:41345832 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AACTACGTGGGGCAGCTGGCGGAGA[C/T]GGTGTTTGGGACGGTGAAGGAGCTG

Phenotype

MIM: 605520

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

LPIN3 PubMed Links

Additional Information

For this assay, SNP(s) [rs16985673] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

LPIN3

Gene Name

lipin 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301860.1	185	Missense Mutation	ACG,ATG	T10M	NP_001288789.1
XM_005260516.2	185	Missense Mutation	ACG,ATG	T10M	XP_005260573.1
XM_006723863.2	185	Missense Mutation	ACG,ATG	T10M	XP_006723926.1
XM_011528996.1	185	Missense Mutation	ACG,ATG	T10M	XP_011527298.1
XM_011528997.2	185	Missense Mutation	ACG,ATG	T10M	XP_011527299.1
XM_011528998.2	185	Missense Mutation	ACG,ATG	T10M	XP_011527300.1
XM_011528999.2	185	Missense Mutation	ACG,ATG	T10M	XP_011527301.1
XM_011529000.1	185	Missense Mutation	ACG,ATG	T10M	XP_011527302.1
XM_011529001.1	185	Missense Mutation	ACG,ATG	T10M	XP_011527303.1
XM_011529002.2	185	Intron			XP_011527304.1
XM_011529003.1	185	Missense Mutation	ACG,ATG	T10M	XP_011527305.1
XM_011529004.1	185	Missense Mutation	ACG,ATG	T10M	XP_011527306.1
XM_011529005.2	185	Missense Mutation	ACG,ATG	T10M	XP_011527307.1
XM_011529006.2	185	Missense Mutation	ACG,ATG	T10M	XP_011527308.1
XM_017028020.1	185	Missense Mutation	ACG,ATG	T10M	XP_016883509.1

View Full Product Details