Product Details

SNP ID: rs147559982
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:31477883 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGGAGAAGACACCACACTGGTGGT[C/T]GTGGACACCTGGGAGGCCGAGAAAC
Phenotype: MIM: 610388
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DEFB124 PubMed Links

Gene Details

Gene: DEFB124
Gene Name: defensin beta 124

There are no transcripts associated with this gene.

Gene: LINC00028
Gene Name: long intergenic non-protein coding RNA 28

There are no transcripts associated with this gene.

Gene: REM1
Gene Name: RRAD and GEM like GTPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014012.5	712	Silent Mutation	GTC,GTT	V132V	NP_054731.2
XM_005260404.1	712	Silent Mutation	GTC,GTT	V140V	XP_005260461.1
XM_011528795.1	712	Silent Mutation	GTC,GTT	V138V	XP_011527097.1
XM_017027833.1	712	Silent Mutation	GTC,GTT	V140V	XP_016883322.1

View Full Product Details