Product Details

SNP ID: rs141812814
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:176107511 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTCCCCTACTCTTCCAACCTGGC[C/T]CCGCACGTCCAGCCCGTGCGCGAAG
Phenotype: MIM: 142984 MIM: 142986 MIM: 142988
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HOXD10 PubMed Links

Gene Details

Gene: HOXD10
Gene Name: homeobox D10

There are no transcripts associated with this gene.

Gene: HOXD11
Gene Name: homeobox D11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021192.2	156	Silent Mutation	GCC,GCT	A52A	NP_067015.2

Gene: HOXD12
Gene Name: homeobox D12

There are no transcripts associated with this gene.

Gene: LOC107985805
Gene Name: sine oculis-binding protein homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017005448.1	156	Intron			XP_016860937.1

View Full Product Details