Product Details

SNP ID: rs138693457
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:57268402 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTATTCATCTGTTCTTTAGGATC[A/G]TAGGGCATCAGAAAAACAAAAAGAA
Phenotype: MIM: 604299
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APPL1 PubMed Links

Gene Details

Gene: APPL1
Gene Name: adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012096.2	2098	Missense Mutation	CAT,CGT	H633R	NP_036228.1
XM_011533583.2	2098	Missense Mutation	CAT,CGT	H616R	XP_011531885.1

Gene: ASB14
Gene Name: ankyrin repeat and SOCS box containing 14

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142733.2	2098	UTR 3			NP_001136205.2
NM_130387.5	2098	UTR 3			NP_569058.1
XM_017005736.1	2098	Intron			XP_016861225.1
XM_017005737.1	2098	Intron			XP_016861226.1

Gene: LOC105377102
Gene Name: uncharacterized LOC105377102

There are no transcripts associated with this gene.

View Full Product Details