Product Details

SNP ID: rs139536893
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50286693 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCCAGCAGGCACACTGCGCCCCTA[A/T]CTAACTGAAGAGGCACGACCGTGGG
Phenotype: MIM: 604038 MIM: 602725 MIM: 607073 MIM: 601281
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: HYAL3 PubMed Links

Gene Details

Gene: HYAL3
Gene Name: hyaluronoglucosaminidase 3

There are no transcripts associated with this gene.

Gene: IFRD2
Gene Name: interferon related developmental regulator 2

There are no transcripts associated with this gene.

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304385.1	276	Nonsense Mutation	TAA,TAT	*63Y	NP_001291314.1
NM_153215.2	276	Nonsense Mutation	TAA,TAT	*64Y	NP_694947.1
XM_006712979.3	276	Nonsense Mutation	TAA,TAT	*73Y	XP_006713042.1
XM_006712980.3	276	Nonsense Mutation	TAA,TAT	*72Y	XP_006713043.1
XM_011533370.2	276	Nonsense Mutation	TAA,TAT	*40Y	XP_011531672.1

Gene: NAT6
Gene Name: N-acetyltransferase 6

There are no transcripts associated with this gene.

Gene: SEMA3B
Gene Name: semaphorin 3B

There are no transcripts associated with this gene.

View Full Product Details