Product Details

SNP ID: rs146554939
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:128481188 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGGCAGCTGCACTGAAGGGGGAT[A/G]ACTTCTCCTGCATGCACTTTGACAG
Phenotype: MIM: 137295
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJB8-AS1 PubMed Links

Gene Details

Gene: DNAJB8-AS1
Gene Name: DNAJB8 antisense RNA 1

There are no transcripts associated with this gene.

Gene: GATA2
Gene Name: GATA binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145661.1	1608	Missense Mutation	TCA,TTA	S425L	NP_001139133.1
NM_001145662.1	1608	Missense Mutation	TCA,TTA	S411L	NP_001139134.1
NM_032638.4	1608	Missense Mutation	TCA,TTA	S425L	NP_116027.2

Gene: GATA2-AS1
Gene Name: GATA2 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details