Product Details

SNP ID

rs147014655

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.3:50572194 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GATGGTGCCCCCAGTGTTTATTCCT[C/T]GGCCAGAAACAGAGGTAGGTGTGCC

Phenotype

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

C3orf18 PubMed Links

Additional Information

For this assay, SNP(s) [rs2232248] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

C3orf18

Gene Name

chromosome 3 open reading frame 18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171740.2	997	Intron			NP_001165211.1
NM_001171741.2	997	Intron			NP_001165212.1
NM_001171743.2	997	Intron			NP_001165214.2
NM_016210.4	997	Intron			NP_057294.2
XM_011533781.2	997	Intron			XP_011532083.1
XM_011533782.2	997	Intron			XP_011532084.1
XM_011533783.2	997	Intron			XP_011532085.1
XM_011533784.2	997	Intron			XP_011532086.1
XM_011533785.2	997	Intron			XP_011532087.1
XM_011533788.1	997	Intron			XP_011532090.1
XM_011533789.1	997	Intron			XP_011532091.1
XM_011533790.1	997	Intron			XP_011532092.1
XM_017006545.1	997	Intron			XP_016862034.1
XM_017006546.1	997	Intron			XP_016862035.1
XM_017006547.1	997	Intron			XP_016862036.1

Gene

HEMK1

Gene Name

HemK methyltransferase family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317851.1	997	Missense Mutation	CGG,TGG	R134W	NP_001304780.1
NM_016173.4	997	Missense Mutation	CGG,TGG	R134W	NP_057257.1
XM_005265218.3	997	Missense Mutation	CGG,TGG	R134W	XP_005265275.1
XM_011533806.2	997	Missense Mutation	CGG,TGG	R134W	XP_011532108.1
XM_011533807.1	997	Missense Mutation	CGG,TGG	R134W	XP_011532109.1
XM_011533808.1	997	Missense Mutation	CGG,TGG	R134W	XP_011532110.1
XM_011533809.2	997	Missense Mutation	CGG,TGG	R134W	XP_011532111.1
XM_011533810.2	997	Missense Mutation	CGG,TGG	R134W	XP_011532112.1
XM_011533812.2	997	Missense Mutation	CGG,TGG	R134W	XP_011532114.1
XM_011533813.2	997	Missense Mutation	CGG,TGG	R27W	XP_011532115.1
XM_011533814.2	997	Missense Mutation	CGG,TGG	R27W	XP_011532116.1

View Full Product Details