Product Details

SNP ID: rs150931238
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49804209 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGGTCGGGACACAGGCTCACCCT[C/G]AATGCCTGGTCCCCTGCAGCCAACC
Phenotype: MIM: 191325
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CDHR4 PubMed Links

Gene Details

Gene: CDHR4
Gene Name: cadherin related family member 4

There are no transcripts associated with this gene.

Gene: FAM212A
Gene Name: family with sequence similarity 212 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_203370.1	219	Missense Mutation	TCA,TGA	S29*	NP_976248.1
XM_017006372.1	219	Nonsense Mutation	TCA,TGA	S88*	XP_016861861.1

Gene: MIR5193
Gene Name: microRNA 5193

There are no transcripts associated with this gene.

Gene: UBA7
Gene Name: ubiquitin like modifier activating enzyme 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003335.2	219	Intron			NP_003326.2
XM_005265430.2	219	Intron			XP_005265487.1
XM_006713321.2	219	Intron			XP_006713384.1
XM_011534070.1	219	Intron			XP_011532372.1
XM_011534071.1	219	Intron			XP_011532373.1
XM_011534072.1	219	Intron			XP_011532374.1

View Full Product Details