Product Details

SNP ID: rs139803589
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.4:55080163 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTGCTTTTGCTGGGCACCATTCC[A/T]CTGCAGAAGAAATGGCAAACAAAGG
Phenotype: MIM: 191306
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: KDR PubMed Links
Additional Information: For this assay, SNP(s) [rs10006115] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002253.2	4151	Silent Mutation	GGA,GGT	G1283G	NP_002244.1