Product Details
- SNP ID
-
rs141392731
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:135571864 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGAGGTTTTTCACCCTATTCTTCGT[A/G]GACCCTGGGGAGAAAAAACACATGT
- Phenotype
-
MIM: 604186
MIM: 616150
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CXCL14
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2547] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CXCL14
- Gene Name
- C-X-C motif chemokine ligand 14
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_004887.4 |
790 |
Missense Mutation |
CAC,TAC |
H109Y |
NP_004878.2 |
- Gene
- SLC25A48
- Gene Name
- solute carrier family 25 member 48
There are no transcripts associated with this gene.
View Full Product Details