Product Details

SNP ID: rs145787718
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140558601 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGATAAGTTTAGGGCATATGGAGC[A/G]GAGAGGGTTTCAGCCGGAAGGCATC
Phenotype: MIM: 602711 MIM: 603483 MIM: 603819
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKHD1-EIF4EBP3 PubMed Links

Gene Details

Gene: ANKHD1-EIF4EBP3
Gene Name: ANKHD1-EIF4EBP3 readthrough

There are no transcripts associated with this gene.

Gene: APBB3
Gene Name: amyloid beta precursor protein binding family B member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006051.3	1798	Missense Mutation	CCG,CTG	P489L	NP_006042.3
NM_133172.2	1798	Missense Mutation	CCG,CTG	P487L	NP_573418.2
NM_133173.2	1798	Missense Mutation	CCG,CTG	P482L	NP_573419.2
NM_133174.2	1798	Missense Mutation	CCG,CTG	P480L	NP_573420.2

Gene: EIF4EBP3
Gene Name: eukaryotic translation initiation factor 4E binding protein 3

There are no transcripts associated with this gene.

Gene: MIR6831
Gene Name: microRNA 6831

There are no transcripts associated with this gene.

Gene: SLC35A4
Gene Name: solute carrier family 35 member A4

There are no transcripts associated with this gene.

Gene: SRA1
Gene Name: steroid receptor RNA activator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001035235.3	1798	Intron			NP_001030312.2
NM_001253764.1	1798	Intron			NP_001240693.1

View Full Product Details