Product Details

SNP ID: rs143228836
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:30723410 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGCGCCGAGCTGGTTGATTCTGT[C/T]CTGGATGTGGTACGGAAGGAGGCAG
Phenotype: MIM: 606998 MIM: 607593 MIM: 191130
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FLOT1 PubMed Links

Gene Details

Gene: FLOT1
Gene Name: flotillin 1

There are no transcripts associated with this gene.

Gene: MDC1
Gene Name: mediator of DNA damage checkpoint 1

There are no transcripts associated with this gene.

Gene: TUBB
Gene Name: tubulin beta class I

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293212.1	738	Silent Mutation	GTC,GTT	V136V	NP_001280141.1
NM_001293213.1	738	Silent Mutation	GTC,GTT	V116V	NP_001280142.1
NM_001293214.1	738	Silent Mutation	GTC,GTT	V72V	NP_001280143.1
NM_001293215.1	738	Silent Mutation	GTC,GTT	V44V	NP_001280144.1
NM_001293216.1	738	Silent Mutation	GTC,GTT	V44V	NP_001280145.1
NM_178014.3	738	Silent Mutation	GTC,GTT	V116V	NP_821133.1

View Full Product Details