Product Details

SNP ID: rs145957272
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31763521 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTGAAGACCATCTGAGGGAGGCAC[A/G]GCGACAGCAGCTGCATCTAGGGGCC
Phenotype: MIM: 603382 MIM: 609693
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MSH5 PubMed Links

Gene Details

Gene: MSH5
Gene Name: mutS homolog 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002441.4	280	Intron			NP_002432.1
NM_025259.5	280	Intron			NP_079535.4
NM_172165.3	280	Intron			NP_751897.1
NM_172166.3	280	Intron			NP_751898.1

Gene: MSH5-SAPCD1
Gene Name: MSH5-SAPCD1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: SAPCD1
Gene Name: suppressor APC domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039651.1	280	Missense Mutation	CAG,CGG	Q74R	NP_001034740.1

Gene: SAPCD1-AS1
Gene Name: SAPCD1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: VWA7
Gene Name: von Willebrand factor A domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025258.2	280	Intron			NP_079534.2
XM_005249427.2	280	Intron			XP_005249484.1
XM_017011327.1	280	Intron			XP_016866816.1
XM_017011328.1	280	Intron			XP_016866817.1
XM_017011329.1	280	Intron			XP_016866818.1

View Full Product Details