Product Details

SNP ID: rs80001134
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31972121 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTGACACCAACGTGGCCACCGGCG[C/T]CCCTCCACGCCGCCAACGAGTCCCC
Phenotype: MIM: 120810 MIM: 605996 MIM: 600478 MIM: 604977
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C4A PubMed Links

Gene Details

Gene: C4A
Gene Name: complement component 4A (Rodgers blood group)

There are no transcripts associated with this gene.

Gene: DXO
Gene Name: decapping exoribonuclease

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005510.3	253	UTR 5			NP_005501.2
XM_006715005.3	253	UTR 5			XP_006715068.1
XM_017010329.1	253	UTR 5			XP_016865818.1

Gene: SKIV2L
Gene Name: Ski2 like RNA helicase

There are no transcripts associated with this gene.

Gene: STK19
Gene Name: serine/threonine kinase 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004197.1	253	Missense Mutation	GCC,GTC	A42V	NP_004188.1
NM_032454.1	253	Missense Mutation	GCC,GTC	A42V	NP_115830.1

View Full Product Details