Product Details

SNP ID: rs138701979
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:44073372 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTCCTCTGAAGCCGCTTGGAAAAA[C/T]GTCTTCTGCAACAGAAGCAGGACTT
Phenotype: MIM: 612931 MIM: 606344
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6838 PubMed Links

Gene Details

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284330.1	1414	Missense Mutation	CAT,CGT	H406R	NP_001271259.1
NM_001284331.1	1414	Silent Mutation	ACA,ACG	T431T	NP_001271260.1
NM_013284.3	1414	Silent Mutation	ACA,ACG	T468T	NP_037416.1
XM_005249711.2	1414	Missense Mutation	CAT,CGT	H346R	XP_005249768.1
XM_006715692.2	1414	Missense Mutation	CAT,CGT	H486R	XP_006715755.1
XM_006715696.2	1414	Missense Mutation	CAT,CGT	H396R	XP_006715759.1
XM_006715698.3	1414	Missense Mutation	CAT,CGT	H259R	XP_006715761.1
XM_011515275.1	1414	Missense Mutation	CAT,CGT	H491R	XP_011513577.1
XM_011515278.1	1414	Missense Mutation	CAT,CGT	H441R	XP_011513580.1
XM_011515279.1	1414	Silent Mutation	ACA,ACG	T473T	XP_011513581.1
XM_011515282.2	1414	Missense Mutation	CAT,CGT	H258R	XP_011513584.1
XM_011515285.1	1414	Missense Mutation	CAT,CGT	H222R	XP_011513587.1
XM_011515286.2	1414	Intron			XP_011513588.1
XM_011515287.2	1414	Intron			XP_011513589.1
XM_017011998.1	1414	Missense Mutation	CAT,CGT	H429R	XP_016867487.1
XM_017011999.1	1414	Missense Mutation	CAT,CGT	H411R	XP_016867488.1
XM_017012000.1	1414	Silent Mutation	ACA,ACG	T423T	XP_016867489.1
XM_017012001.1	1414	Silent Mutation	ACA,ACG	T393T	XP_016867490.1
XM_017012002.1	1414	Missense Mutation	CAT,CGT	H222R	XP_016867491.1
XM_017012003.1	1414	Missense Mutation	CAT,CGT	H222R	XP_016867492.1
XM_017012004.1	1414	Intron			XP_016867493.1
XM_017012005.1	1414	Intron			XP_016867494.1