Product Details

SNP ID: rs140812225
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:149875617 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCAGAGTGATCATCACCATGCTG[A/G]TCGCCACCGCCGTCTGCTGTTACCT
Phenotype: MIM: 611019
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACTR3C PubMed Links

Gene Details

Gene: ACTR3C
Gene Name: ARP3 actin-related protein 3 homolog C

There are no transcripts associated with this gene.

Gene: ATP6V0E2
Gene Name: ATPase H+ transporting V0 subunit e2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001100592.2	1222	Missense Mutation	ATC,GTC	I91V	NP_001094062.1
NM_001289990.1	1222	Missense Mutation	ATC,GTC	I91V	NP_001276919.1
NM_145230.3	1222	Missense Mutation	ATC,GTC	I91V	NP_660265.2

Gene: ATP6V0E2-AS1
Gene Name: ATP6V0E2 antisense RNA 1

There are no transcripts associated with this gene.

Gene: ZNF862
Gene Name: zinc finger protein 862

There are no transcripts associated with this gene.

View Full Product Details