Product Details

SNP ID: rs141002347
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:150792077 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCACCAGGGGCTGGGAGCTCTGGCC[A/C]CACAAGTTTCGAAGACCTACTCCCA
Phenotype: MIM: 610334 MIM: 610385
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC105375566 PubMed Links

Gene Details

Gene: LOC105375566
Gene Name: uncharacterized LOC105375566

There are no transcripts associated with this gene.

Gene: TMEM176A
Gene Name: transmembrane protein 176A

There are no transcripts associated with this gene.

Gene: TMEM176B
Gene Name: transmembrane protein 176B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001101311.1	716	Missense Mutation	TGG,TGT	W233C	NP_001094781.1
NM_001101312.1	716	Missense Mutation	TGG,TGT	W233C	NP_001094782.1
NM_001101314.1	716	Missense Mutation	TGG,TGT	W196C	NP_001094784.1
NM_014020.3	716	Missense Mutation	TGG,TGT	W233C	NP_054739.3
XM_006715933.3	716	Missense Mutation	TGG,TGT	W196C	XP_006715996.2

View Full Product Details