Product Details

SNP ID: rs142807595
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:143286052 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGGGCTGGCTTTGCTGGGCATAA[A/G]GACGGACATCACCCCCGTTGCTTAT
Phenotype: MIM: 600639 MIM: 616524
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CASP2 PubMed Links

Gene Details

Gene: CASP2
Gene Name: caspase 2

There are no transcripts associated with this gene.

Gene: LOC105375545
Gene Name: uncharacterized LOC105375545

There are no transcripts associated with this gene.

Gene: TMEM139
Gene Name: transmembrane protein 139

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242773.2	188	Missense Mutation	AAG,AGG	K32R	NP_001229702.1
NM_001242774.2	188	Missense Mutation	AAG,AGG	K32R	NP_001229703.1
NM_001242775.2	188	Missense Mutation	AAG,AGG	K32R	NP_001229704.1
NM_001282876.1	188	Missense Mutation	AAG,AGG	K32R	NP_001269805.1
NM_001282877.1	188	Missense Mutation	AAG,AGG	K32R	NP_001269806.1
NM_153345.3	188	Missense Mutation	AAG,AGG	K32R	NP_699176.1

View Full Product Details