Product Details

SNP ID: rs146318307
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:44073297 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGGGGACACAGGCAGGCTCAGGC[A/G]TTTCTCTGCTCTGGAGGAAGGTACT
Phenotype: MIM: 612931 MIM: 606344
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6838 PubMed Links

Gene Details

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284330.1	1489	Missense Mutation	ACG,ATG	T431M	NP_001271259.1
NM_001284331.1	1489	Silent Mutation	AAC,AAT	N456N	NP_001271260.1
NM_013284.3	1489	Silent Mutation	AAC,AAT	N493N	NP_037416.1
XM_005249711.2	1489	Missense Mutation	ACG,ATG	T371M	XP_005249768.1
XM_006715692.2	1489	Missense Mutation	ACG,ATG	T511M	XP_006715755.1
XM_006715696.2	1489	Missense Mutation	ACG,ATG	T421M	XP_006715759.1
XM_006715698.3	1489	Missense Mutation	ACG,ATG	T284M	XP_006715761.1
XM_011515275.1	1489	Missense Mutation	ACG,ATG	T516M	XP_011513577.1
XM_011515278.1	1489	Missense Mutation	ACG,ATG	T466M	XP_011513580.1
XM_011515279.1	1489	Silent Mutation	AAC,AAT	N498N	XP_011513581.1
XM_011515282.2	1489	Missense Mutation	ACG,ATG	T283M	XP_011513584.1
XM_011515285.1	1489	Missense Mutation	ACG,ATG	T247M	XP_011513587.1
XM_011515286.2	1489	Intron			XP_011513588.1
XM_011515287.2	1489	Intron			XP_011513589.1
XM_017011998.1	1489	Missense Mutation	ACG,ATG	T454M	XP_016867487.1
XM_017011999.1	1489	Missense Mutation	ACG,ATG	T436M	XP_016867488.1
XM_017012000.1	1489	Silent Mutation	AAC,AAT	N448N	XP_016867489.1
XM_017012001.1	1489	Silent Mutation	AAC,AAT	N418N	XP_016867490.1
XM_017012002.1	1489	Missense Mutation	ACG,ATG	T247M	XP_016867491.1
XM_017012003.1	1489	Missense Mutation	ACG,ATG	T247M	XP_016867492.1
XM_017012004.1	1489	Intron			XP_016867493.1
XM_017012005.1	1489	Intron			XP_016867494.1