Product Details

SNP ID: rs147996458
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:44115799 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAGGGGCTGTGGGGCTGATGTGAC[A/G]GACCCGCAGGGTCCACTCCAGGATC
Phenotype: MIM: 602981 MIM: 600815
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AEBP1 PubMed Links

Gene Details

Gene: AEBP1
Gene Name: AE binding protein 1

There are no transcripts associated with this gene.

Gene: MIR4649
Gene Name: microRNA 4649

There are no transcripts associated with this gene.

Gene: POLD2
Gene Name: DAN polymerase delta 2, accessory subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127218.2	1764	Missense Mutation	CGT,TGT	R372C	NP_001120690.1
NM_001256879.1	1764	Missense Mutation	CGT,TGT	R372C	NP_001243808.1
NM_006230.3	1764	Missense Mutation	CGT,TGT	R407C	NP_006221.2
XM_011515431.1	1764	Missense Mutation	CGT,TGT	R405C	XP_011513733.1

View Full Product Details