Product Details

SNP ID: rs145544925
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144106429 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACCACAGCTGTGGAACGCGGTGGA[C/T]GAGGAGATCTGCCTGGCTGAATGTG
Phenotype: MIM: 123980 MIM: 610210 MIM: 611885
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYC1 PubMed Links

Gene Details

Gene: CYC1
Gene Name: cytochrome c1

There are no transcripts associated with this gene.

Gene: MAF1
Gene Name: MAF1 homolog, negative regulator of RNA polymerase III

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032272.4	1089	Silent Mutation	GAC,GAT	D155D	NP_115648.2
XM_017013903.1	1089	Silent Mutation	GAC,GAT	D155D	XP_016869392.1
XM_017013904.1	1089	Intron			XP_016869393.1

Gene: SHARPIN
Gene Name: SHANK associated RH domain interactor

There are no transcripts associated with this gene.

Gene: WDR97
Gene Name: WD repeat domain 97

There are no transcripts associated with this gene.

View Full Product Details