Product Details
- SNP ID
-
rs148247595
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.8:103415316 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCGGCGCAGGATCCAGTTGAGCCAG[C/G]AGGCCGCCGCTCCGCGAGTCACGTG
- Phenotype
-
MIM: 616196
MIM: 610815
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
DCAF13
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs3134296] are located under a probe and SNP(s) [rs3134297] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DCAF13
- Gene Name
- DDB1 and CUL4 associated factor 13
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_015420.6 |
20 |
Missense Mutation |
GCA,GGA |
A109G |
NP_056235.4 |
- Gene
- SLC25A32
- Gene Name
- solute carrier family 25 member 32
View Full Product Details