Product Details

SNP ID: rs141428638
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136849449 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGAACATGGCGGTGGCGGACCTC[C/G]CTCTCATTCCTGATGTGGACATCGA
Phenotype: MIM: 610167 MIM: 610615
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C9orf172 PubMed Links

Gene Details

Gene: C9orf172
Gene Name: chromosome 9 open reading frame 172

There are no transcripts associated with this gene.

Gene: MAMDC4
Gene Name: MAM domain containing 4

There are no transcripts associated with this gene.

Gene: PHPT1
Gene Name: phosphohistidine phosphatase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135861.2	634	Missense Mutation	CCT,GCT	P7A	NP_001129333.1
NM_001287342.1	634	Missense Mutation	CCT,GCT	P7A	NP_001274271.1
NM_001287343.1	634	Missense Mutation	CCT,GCT	P7A	NP_001274272.1
NM_014172.5	634	Missense Mutation	CCT,GCT	P7A	NP_054891.2

Gene: RABL6
Gene Name: RAB, member RAS oncogene family-like 6

There are no transcripts associated with this gene.

View Full Product Details