Product Details

SNP ID: rs142589658
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137459999 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAAACATCACACGGCAGCATCAGG[G/T]CTCCCACACCTCACAGGGCAGCAGG
Phenotype: MIM: 608137 MIM: 612122
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR7114 PubMed Links

Gene Details

Gene: MIR7114
Gene Name: microRNA 7114

There are no transcripts associated with this gene.

Gene: NSMF
Gene Name: NMDA receptor synaptonuclear signaling and neuronal migration factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130969.1	4795	Intron			NP_001124441.1
NM_001130970.1	4795	Intron			NP_001124442.1
NM_001130971.1	4795	Intron			NP_001124443.1
NM_001178064.1	4795	Intron			NP_001171535.1
NM_015537.4	4795	Intron			NP_056352.3
XM_005266061.4	4795	Intron			XP_005266118.1
XM_005266062.4	4795	Intron			XP_005266119.1
XM_011518496.2	4795	Intron			XP_011516798.1
XM_011518497.2	4795	Intron			XP_011516799.1
XM_017014597.1	4795	Intron			XP_016870086.1

Gene: PNPLA7
Gene Name: patatin like phospholipase domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098537.2	4795	UTR 3			NP_001092007.2
NM_152286.4	4795	UTR 3			NP_689499.4
XM_006717102.1	4795	UTR 3			XP_006717165.1
XM_006717104.3	4795	UTR 3			XP_006717167.1
XM_011518664.2	4795	Intron			XP_011516966.1
XM_017014709.1	4795	UTR 3			XP_016870198.1

View Full Product Details