Product Details

SNP ID: rs146458678
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:133666831 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCGGACATGGCCCACCACTTGGCC[A/G]TTCCTCCAGATGGCCTCCAGGCCAA
Phenotype: MIM: 609312 MIM: 604455
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DBH PubMed Links

Gene Details

Gene: DBH
Gene Name: dopamine beta-hydroxylase

There are no transcripts associated with this gene.

Gene: DBH-AS1
Gene Name: DBH antisense RNA 1

There are no transcripts associated with this gene.

Gene: SARDH
Gene Name: sarcosine dehydrogenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134707.1	2831	Silent Mutation			NP_001128179.1
NM_007101.3	2831	Silent Mutation			NP_009032.2
XM_017014367.1	2831	Silent Mutation			XP_016869856.1
XM_017014368.1	2831	Intron			XP_016869857.1

View Full Product Details