Product Details
- SNP ID
-
rs147645466
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:104535945 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AATCAGGTCTTGAGACTTCGGTTTC[A/G]CATACATAAAGAAGATGGTACCGTA
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR13C3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs41312212] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR13C3
- Gene Name
- olfactory receptor family 13 subfamily C member 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001001961.1 |
869 |
Missense Mutation |
GCG,GTG |
A290V |
NP_001001961.1 |
- Gene
- OR13C4
- Gene Name
- olfactory receptor family 13 subfamily C member 4
There are no transcripts associated with this gene.
View Full Product Details