Product Details

SNP ID: rs11557708
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:26192081 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACACTCTTACAAAGACCACTAGAAA[A/G]AAACAACAATTAAAAAGCTAAGAAA
Phenotype: MIM: 604477 MIM: 600124 MIM: 604135
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CBX3 PubMed Links

Gene Details

Gene: CBX3
Gene Name: chromobox 3

There are no transcripts associated with this gene.

Gene: HNRNPA2B1
Gene Name: heterogeneous nuclear ribonucleoprotein A2/B1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002137.3	1557	UTR 3			NP_002128.1
NM_031243.2	1557	UTR 3			NP_112533.1
XM_005249729.1	1557	Intron			XP_005249786.1
XM_017012109.1	1557	Intron			XP_016867598.1
XM_017012110.1	1557	Intron			XP_016867599.1

Gene: NFE2L3
Gene Name: nuclear factor, erythroid 2 like 3

There are no transcripts associated with this gene.

View Full Product Details