Product Details

SNP ID

rs11557532

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:82444072 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGAGACAGCTCTGTGGGGCTCTCAA[G/A]GCAGTGCAGCTCCAGGAAGCTGGTG

Phenotype

MIM: 616864

Polymorphism

G/A, Transition Substitution

Allele Nomenclature

Literature Links

C17orf62 PubMed Links

Additional Information

For this assay, SNP(s) [rs2306758] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

C17orf62

Gene Name

chromosome 17 open reading frame 62

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033046.3	661	Missense Mutation	CTT,TTT	L166F	NP_001028218.1
NM_001100407.2	661	Missense Mutation	CTT,TTT	L166F	NP_001093877.1
NM_001100408.2	661	Missense Mutation	CTT,TTT	L152F	NP_001093878.1
NM_001193653.1	661	Missense Mutation	CTT,TTT	L166F	NP_001180582.1
NM_001193654.1	661	Missense Mutation	CTT,TTT	L166F	NP_001180583.1
NM_001193655.1	661	Missense Mutation	CTT,TTT	L166F	NP_001180584.1
NM_001193657.1	661	Missense Mutation	CTT,TTT	L166F	NP_001180586.1
XM_006722293.2	661	Missense Mutation	CTT,TTT	L152F	XP_006722356.1
XM_011523606.2	661	Missense Mutation	CTT,TTT	L199F	XP_011521908.1
XM_017025072.1	661	Missense Mutation	CTT,TTT	L199F	XP_016880561.1
XM_017025073.1	661	Missense Mutation	CTT,TTT	L185F	XP_016880562.1
XM_017025074.1	661	Missense Mutation	CTT,TTT	L166F	XP_016880563.1
XM_017025075.1	661	Missense Mutation	CTT,TTT	L166F	XP_016880564.1
XM_017025076.1	661	Missense Mutation	CTT,TTT	L166F	XP_016880565.1
XM_017025077.1	661	Missense Mutation	CTT,TTT	L166F	XP_016880566.1
XM_017025078.1	661	Missense Mutation	CTT,TTT	L152F	XP_016880567.1

Gene

HEXDC

Gene Name

hexosaminidase D

There are no transcripts associated with this gene.

View Full Product Details