Product Details

SNP ID: rs181405526
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:1310658 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGCTGCGGTTCTGGAACCTGGA[A/G]TTTGAGAGCCAGTCTTTCCTGTATA
Phenotype: MIM: 611354
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACAP3 PubMed Links

Gene Details

Gene: ACAP3
Gene Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 3

There are no transcripts associated with this gene.

Gene: CPSF3L
Gene Name: cleavage and polyadenylation specific factor 3-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256456.1	699	Intron			NP_001243385.1
NM_001256460.1	699	Intron			NP_001243389.1
NM_001256462.1	699	Intron			NP_001243391.1
NM_001256463.1	699	Intron			NP_001243392.1
NM_017871.5	699	Intron			NP_060341.2
XM_011541647.1	699	Intron			XP_011539949.1
XM_011541648.1	699	Intron			XP_011539950.1
XM_011541650.1	699	Intron			XP_011539952.1
XM_017001557.1	699	Intron			XP_016857046.1
XM_017001558.1	699	Intron			XP_016857047.1

Gene: MIR6727
Gene Name: microRNA 6727

There are no transcripts associated with this gene.

Gene: PUSL1
Gene Name: pseudouridylate synthase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153339.1	699	Silent Mutation	GAA,GAG	E223E	NP_699170.1
XM_005244720.3	699	Missense Mutation	AAT,AGT	N215S	XP_005244777.1

View Full Product Details