Product Details

SNP ID

rs181802264

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.11:49208400 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACAGCCGAGTCGGTTTCGTGAAGGA[A/G]ATTCCACATCTCGGCGCGAGCAGAG

Phenotype

MIM: 600934

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

FOLH1 PubMed Links

Additional Information

For this assay, SNP(s) [rs200069827] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

FOLH1

Gene Name

folate hydrolase (prostate-specific membrane antigen) 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014986.1	271	Missense Mutation	CTC,TTC	L4F	NP_001014986.1
NM_001193471.1	271	UTR 5			NP_001180400.1
NM_001193472.1	271	UTR 5			NP_001180401.1
NM_001193473.1	271	UTR 5			NP_001180402.1
NM_004476.1	271	Missense Mutation	CTC,TTC	L4F	NP_004467.1
XM_011519958.2	271	Missense Mutation	CTC,TTC	L4F	XP_011518260.2
XM_017017432.1	271	Missense Mutation	CTC,TTC	L4F	XP_016872921.1
XM_017017433.1	271	Missense Mutation	CTC,TTC	L4F	XP_016872922.1
XM_017017434.1	271	Intron			XP_016872923.1
XM_017017435.1	271	Intron			XP_016872924.1
XM_017017436.1	271	UTR 5			XP_016872925.1
XM_017017437.1	271	Intron			XP_016872926.1
XM_017017438.1	271	UTR 5			XP_016872927.1
XM_017017439.1	271	Intron			XP_016872928.1
XM_017017440.1	271	Intron			XP_016872929.1
XM_017017441.1	271	Intron			XP_016872930.1
XM_017017442.1	271	Intron			XP_016872931.1
XM_017017443.1	271	Intron			XP_016872932.1
XM_017017444.1	271	UTR 5			XP_016872933.1
XM_017017445.1	271	UTR 5			XP_016872934.1
XM_017017446.1	271	UTR 5			XP_016872935.1
XM_017017447.1	271	Intron			XP_016872936.1
XM_017017448.1	271	Intron			XP_016872937.1
XM_017017449.1	271	UTR 5			XP_016872938.1
XM_017017450.1	271	UTR 5			XP_016872939.1
XM_017017451.1	271	Intron			XP_016872940.1

View Full Product Details