Product Details

SNP ID: rs183788679
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:103403240 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGTCACTGAAATCTGTGATGCCTA[C/T]ACCAAAAAGCTGAATGAGCAGGTGA
Phenotype: MIM: 612333 MIM: 615204
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR1307 PubMed Links

Gene Details

Gene: MIR1307
Gene Name: microRNA 1307

There are no transcripts associated with this gene.

Gene: PDCD11
Gene Name: programmed cell death 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014976.1	484	Silent Mutation	TAC,TAT	Y119Y	NP_055791.1
XM_005269647.3	484	Silent Mutation	TAC,TAT	Y119Y	XP_005269704.1
XM_011539538.2	484	Silent Mutation	TAC,TAT	Y119Y	XP_011537840.1
XM_011539539.2	484	Silent Mutation	TAC,TAT	Y119Y	XP_011537841.1
XM_011539540.1	484	Silent Mutation	TAC,TAT	Y36Y	XP_011537842.1

Gene: USMG5
Gene Name: up-regulated during skeletal muscle growth 5 homolog (mouse)

There are no transcripts associated with this gene.

View Full Product Details