Product Details

SNP ID: rs188027862
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:39415383 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGACGGCGGGGTCCTGGGGCTGAG[C/T]GTGGAGCAGGTGGGCACGCTGTTTG
Phenotype: MIM: 611893 MIM: 190700
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR4530 PubMed Links

Gene Details

Gene: MIR4530
Gene Name: microRNA 4530

There are no transcripts associated with this gene.

Gene: PLEKHG2
Gene Name: pleckstrin homology and RhoGEF domain containing G2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022835.2	1279	Silent Mutation	AGC,AGT	S141S	NP_073746.2
XM_005259163.2	1279	Silent Mutation	AGC,AGT	S141S	XP_005259220.1
XM_006723334.2	1279	Silent Mutation	AGC,AGT	S82S	XP_006723397.1
XM_011527232.2	1279	Silent Mutation	AGC,AGT	S142S	XP_011525534.1
XM_017027150.1	1279	Silent Mutation	AGC,AGT	S142S	XP_016882639.1
XM_017027151.1	1279	Silent Mutation	AGC,AGT	S142S	XP_016882640.1

Gene: ZFP36
Gene Name: ZFP36 ring finger protein

There are no transcripts associated with this gene.

View Full Product Details