Product Details

SNP ID: rs188054107
Assay Type: Functionally tested
NCBI dbSNP Submissions: 15
Location: Chr.1:156738523 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTACCCCCTGTATGAGGCTCTCACC[A/G]TGTCCCCACAGAACAGATACCAGTC
Phenotype: MIM: 600339 MIM: 611930 MIM: 611836
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HDGF PubMed Links

Gene Details

Gene: HDGF
Gene Name: hepatoma-derived growth factor

There are no transcripts associated with this gene.

Gene: ISG20L2
Gene Name: interferon stimulated exonuclease gene 20 like 2

There are no transcripts associated with this gene.

Gene: MRPL24
Gene Name: mitochondrial ribosomal protein L24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024540.3	432	Missense Mutation			NP_078816.2
NM_145729.2	432	Missense Mutation			NP_663781.1
XM_011509981.2	432	Missense Mutation			XP_011508283.1
XM_011509982.2	432	Missense Mutation			XP_011508284.1

Gene: RRNAD1
Gene Name: ribosomal RNA adenine dimethylase domain containing 1

There are no transcripts associated with this gene.

View Full Product Details