Product Details

SNP ID: rs189650562
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:17271653 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACTGCCAAAGCTGGAGTCGTTCAA[C/T]GGGTAAGAGGGACATTTTAGGGCTT
Phenotype: MIM: 612766 MIM: 611810
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ANKLE1 PubMed Links

Gene Details

Gene: ANKLE1
Gene Name: ankyrin repeat and LEM domain containing 1

There are no transcripts associated with this gene.

Gene: BABAM1
Gene Name: BRISC and BRCA1 A complex member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033549.2	545	Silent Mutation	AAC,AAT	N114N	NP_001028721.1
NM_001288756.1	545	Silent Mutation	AAC,AAT	N114N	NP_001275685.1
NM_001288757.1	545	Silent Mutation	AAC,AAT	N114N	NP_001275686.1
NM_014173.3	545	Silent Mutation	AAC,AAT	N114N	NP_054892.2

Gene: USHBP1
Gene Name: USH1 protein network component harmonin binding protein 1

There are no transcripts associated with this gene.

View Full Product Details