Product Details

SNP ID: rs190208400
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28357730 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCGTGCTTTGGGCCCCGGCGGGGA[A/G]CTGGAGCCAGAGCGGCTACCCCGAA
Phenotype: MIM: 611519 MIM: 610975 MIM: 616815 MIM: 193190
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR4723 PubMed Links

Gene Details

Gene: MIR4723
Gene Name: microRNA 4723

There are no transcripts associated with this gene.

Gene: POLDIP2
Gene Name: DNA polymerase delta interacting protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290145.1	150	Intron			NP_001277074.1
NM_015584.4	150	Intron			NP_056399.1

Gene: SEBOX
Gene Name: SEBOX homeobox

There are no transcripts associated with this gene.

Gene: TMEM199
Gene Name: transmembrane protein 199

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152464.2	150	Silent Mutation	GAA,GAG	E20E	NP_689677.1

Gene: VTN
Gene Name: vitronectin

There are no transcripts associated with this gene.

View Full Product Details