Product Details

SNP ID: rs193238470
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:44097877 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTTCCAGAAGTAAGAGGGAAAATG[A/G]CCACGTTCAAGGTGGGTAGGACTTG
Phenotype: MIM: 194555
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100379224 PubMed Links

Gene Details

Gene: LOC100379224
Gene Name: uncharacterized LOC100379224

There are no transcripts associated with this gene.

Gene: ZNF224
Gene Name: zinc finger protein 224

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321645.1	363	Missense Mutation	ACC,GCC	T2A	NP_001308574.1
NM_013398.3	363	Missense Mutation	ACC,GCC	T2A	NP_037530.2
XM_017027261.1	363	Missense Mutation	ACC,GCC	T2A	XP_016882750.1

Gene: ZNF284
Gene Name: zinc finger protein 284

There are no transcripts associated with this gene.

View Full Product Details