Product Details

SNP ID: rs199607772
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:62834279 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAATGTACCCTAGTCCACTCACCTT[A/G]CCGAAGGTCAATTTCTGCCAGCTGC
Phenotype: MIM: 603189
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC105369332 PubMed Links

Gene Details

Gene: LOC105369332
Gene Name: uncharacterized LOC105369332

There are no transcripts associated with this gene.

Gene: RNU2-2P
Gene Name: RNA, U2 small nuclear 2, pseudogene

There are no transcripts associated with this gene.

Gene: STX5
Gene Name: syntaxin 5

There are no transcripts associated with this gene.

Gene: WDR74
Gene Name: WD repeat domain 74

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001307977.1	861	Nonsense Mutation	CAA,TAA	Q258*	NP_001294906.1
NM_018093.3	861	Nonsense Mutation	CAA,TAA	Q258*	NP_060563.2
XM_005274055.2	861	Nonsense Mutation	CAA,TAA	Q258*	XP_005274112.1

View Full Product Details