Product Details

SNP ID: rs199635205
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:124626917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTTTTTTATAGATCATCACCGACC[A/G]ACCTGGCTTTCATGATGAGAGTGCC
Phenotype: MIM: 608422 MIM: 610079 MIM: 610614
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PANX3 PubMed Links

Gene Details

Gene: PANX3
Gene Name: pannexin 3

There are no transcripts associated with this gene.

Gene: SIAE
Gene Name: sialic acid acetylesterase

There are no transcripts associated with this gene.

Gene: TBRG1
Gene Name: transforming growth factor beta regulator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032811.2	649	Missense Mutation	CAA,CGA	Q202R	NP_116200.2
XM_005271709.3	649	Missense Mutation	CAA,CGA	Q55R	XP_005271766.1
XM_017018442.1	649	Missense Mutation	CAA,CGA	Q51R	XP_016873931.1

View Full Product Details