Product Details

SNP ID: rs201108066
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:126304117 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTCCTCAACTAGGCAAGAGGAAG[C/T]GCGAATTGGACGTGGAGGAGGCCCA
Phenotype: MIM: 610534 MIM: 606252
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DCPS PubMed Links

Gene Details

Gene: DCPS
Gene Name: decapping enzyme, scavenger

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014026.4	817	Missense Mutation	CGC,TGC	R13C	NP_054745.1
XM_011542778.2	817	Missense Mutation	CGC,TGC	R13C	XP_011541080.1
XM_011542780.2	817	Intron			XP_011541082.1
XM_017017612.1	817	UTR 5			XP_016873101.1

Gene: HP11014
Gene Name: uncharacterized HP11014

There are no transcripts associated with this gene.

Gene: TIRAP
Gene Name: TIR domain containing adaptor protein

There are no transcripts associated with this gene.

View Full Product Details