Product Details

SNP ID: rs201714024
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:10986221 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGTGCTGAGATCTTGCGATCCTT[A/C]TCCATGGAGCTGCATCTTCTTGAGA
Phenotype: MIM: 168730 MIM: 613962 MIM: 609627
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PRH1 PubMed Links

Gene Details

Gene: PRH1
Gene Name: proline rich protein HaeIII subfamily 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291314.1	692	Intron			NP_001278243.1
NM_001291315.1	692	Intron			NP_001278244.1

Gene: PRH1-PRR4
Gene Name: PRH1-PRR4 readthrough

There are no transcripts associated with this gene.

Gene: PRH1-TAS2R14
Gene Name: PRH1-TAS2R14 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316893.1	692	Intron			NP_001303822.1

Gene: TAS2R20
Gene Name: taste 2 receptor member 20

There are no transcripts associated with this gene.

Gene: TAS2R50
Gene Name: taste 2 receptor member 50

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_176890.2	692	Nonsense Mutation	GAA,TAA	E214*	NP_795371.2

View Full Product Details