Product Details

SNP ID: rs201550362
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6954843 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACATGTCTGGCGGGCAGGCAGAGA[C/T]GCTGCTGCAGGCCAAGGGCGAGCCC
Phenotype: MIM: 615140 MIM: 612093 MIM: 612092 MIM: 176883
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C12orf57 PubMed Links

Gene Details

Gene: C12orf57
Gene Name: chromosome 12 open reading frame 57

There are no transcripts associated with this gene.

Gene: LOC105369635
Gene Name: uncharacterized LOC105369635

There are no transcripts associated with this gene.

Gene: MIR141
Gene Name: microRNA 141

There are no transcripts associated with this gene.

Gene: MIR200C
Gene Name: microRNA 200c

There are no transcripts associated with this gene.

Gene: PTPN6
Gene Name: protein tyrosine phosphatase, non-receptor type 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002831.5	520	Missense Mutation	ACG,ATG	T122M	NP_002822.2
NM_080548.4	520	Missense Mutation	ACG,ATG	T124M	NP_536858.1
NM_080549.3	520	Missense Mutation	ACG,ATG	T122M	NP_536859.1
XM_006718994.1	520	Missense Mutation	ACG,ATG	T8M	XP_006719057.1
XM_011520988.1	520	Missense Mutation	ACG,ATG	T124M	XP_011519290.1

View Full Product Details