Product Details

SNP ID: rs200702900
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:20456750 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACAAACTACCAGCTGAACTTCAGG[A/G]GCTGCCTGGACTCTCTCATCAATAC
Phenotype: MIM: 107748 MIM: 610107 MIM: 609865
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APEX1 PubMed Links

Gene Details

Gene: APEX1
Gene Name: apurinic/apyrimidinic endodeoxyribonuclease 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001244249.1	595	Missense Mutation	GAG,GGG	E110G	NP_001231178.1
NM_001641.3	595	Missense Mutation	GAG,GGG	E110G	NP_001632.2
NM_080648.2	595	Missense Mutation	GAG,GGG	E110G	NP_542379.1
NM_080649.2	595	Missense Mutation	GAG,GGG	E110G	NP_542380.1

Gene: OSGEP
Gene Name: O-sialoglycoprotein endopeptidase

There are no transcripts associated with this gene.

Gene: TMEM55B
Gene Name: transmembrane protein 55B

There are no transcripts associated with this gene.

View Full Product Details