Product Details

SNP ID

rs200244203

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.14:88385821 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CGGCGGCTGCAAGAGGACTAAGCAT[A/G]GATGGCAGCCGGAGAGGTAAAGGGC

Phenotype

MIM: 609868

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

SPATA7 PubMed Links

Additional Information

For this assay, SNP(s) [rs4904448] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SPATA7

Gene Name

spermatogenesis associated 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040428.3	149	Missense Mutation	ATA,ATG	I1M	NP_001035518.1
NM_018418.4	149	Missense Mutation	ATA,ATG	I1M	NP_060888.2
XM_005267851.1	149	Missense Mutation	ATA,ATG	I1M	XP_005267908.1
XM_005267852.1	149	Missense Mutation	ATA,ATG	I1M	XP_005267909.1
XM_005267854.1	149	UTR 5			XP_005267911.1
XM_005267855.1	149	UTR 5			XP_005267912.1
XM_006720204.1	149	Missense Mutation	ATA,ATG	I1M	XP_006720267.1
XM_006720205.1	149	Missense Mutation	ATA,ATG	I1M	XP_006720268.1
XM_011536951.1	149	UTR 5			XP_011535253.1
XM_011536952.1	149	Missense Mutation	ATA,ATG	I1M	XP_011535254.1
XM_011536953.1	149	UTR 5			XP_011535255.1
XM_017021452.1	149	UTR 5			XP_016876941.1
XM_017021453.1	149	UTR 5			XP_016876942.1
XM_017021454.1	149	UTR 5			XP_016876943.1
XM_017021455.1	149	UTR 5			XP_016876944.1
XM_017021456.1	149	Intron			XP_016876945.1
XM_017021457.1	149	UTR 5			XP_016876946.1

View Full Product Details