Product Details

SNP ID: rs201445684
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2966224 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGGCGCTACTGCGACATCCCCTC[C/T]TGTCACAGTGAGTAGCGCGGCTGGA
Phenotype: MIM: 609899 MIM: 614578 MIM: 602474
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KREMEN2 PubMed Links

Gene Details

Gene: KREMEN2
Gene Name: kringle containing transmembrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001253725.1	659	Silent Mutation	TCC,TCT	S118S	NP_001240654.1
NM_001253726.1	659	Silent Mutation	TCC,TCT	S118S	NP_001240655.1
NM_024507.3	659	Silent Mutation	TCC,TCT	S118S	NP_078783.1
NM_172229.2	659	Silent Mutation	TCC,TCT	S118S	NP_757384.1

Gene: PAQR4
Gene Name: progestin and adipoQ receptor family member 4

There are no transcripts associated with this gene.

Gene: PKMYT1
Gene Name: protein kinase, membrane associated tyrosine/threonine 1

There are no transcripts associated with this gene.

View Full Product Details