Product Details

SNP ID: rs200701039
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1834280 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTAAACATGTTTTTGTCCAGACAA[C/G]TTTCTGCTTGCCTCAGTAGGATCTG
Phenotype: MIM: 616320 MIM: 138760
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAHD1 PubMed Links

Gene Details

Gene: FAHD1
Gene Name: fumarylacetoacetate hydrolase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018104.2	1587	Intron			NP_001018114.1
NM_001142398.1	1587	Intron			NP_001135870.1
NM_031208.3	1587	Intron			NP_112485.1

Gene: HAGH
Gene Name: hydroxyacylglutathione hydrolase

There are no transcripts associated with this gene.

Gene: MEIOB
Gene Name: meiosis specific with OB domains

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163560.2	1587	Missense Mutation	AAC,AAG	N464K	NP_001157032.1
NM_152764.2	1587	Missense Mutation	AAC,AAG	N435K	NP_689977.2

View Full Product Details