Product Details

SNP ID: rs200289185
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1775089 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCTGGATCTCCCCCGAGACCACC[A/G]CCCGGCCCCACCTGGCTGTCATCGG
Phenotype: MIM: 610886 MIM: 605431 MIM: 611994 MIM: 601817 MIM: 610779 MIM: 611659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EME2 PubMed Links

Gene Details

Gene: EME2
Gene Name: essential meiotic structure-specific endonuclease subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257370.1	448	Missense Mutation	ACC,GCC	T176A	NP_001244299.1
XM_017023025.1	448	Missense Mutation	ACC,GCC	T148A	XP_016878514.1
XM_017023026.1	448	Missense Mutation	ACC,GCC	T145A	XP_016878515.1

Gene: MAPK8IP3
Gene Name: mitogen-activated protein kinase 8 interacting protein 3

There are no transcripts associated with this gene.

Gene: MRPS34
Gene Name: mitochondrial ribosomal protein S34

There are no transcripts associated with this gene.

Gene: NME3
Gene Name: NME/NM23 nucleoside diphosphate kinase 3

There are no transcripts associated with this gene.

Gene: NUBP2
Gene Name: nucleotide binding protein 2

There are no transcripts associated with this gene.

Gene: SPSB3
Gene Name: splA/ryanodine receptor domain and SOCS box containing 3

There are no transcripts associated with this gene.

View Full Product Details